Command-line usage guide

rna-clique

rna-clique is the main executable of RNA-clique. Given some input transcriptomes, rna-clique gets a genetic distance matrix quantifying differences in the genomes of the provided samples.

Positional arguments

Position	Config option	Description	Argument count	Type
0	input_dirs	Directories containing the transcript FASTA files.	\(\ge 0\)	list[pathlib.Path]

Options

Config option	Long name	Short name	Description	Argument count	Type	Choices	Default value	Default value (flag only)	Required
	--input-config	-c	File from which to load configuration settings.	\(1\)	pathlib.Path		OUTPUT_DIR/config.yaml		No
	--show-config		Display the computed configuration or arguments.	\(\ge 0\)	list[str]	original_args, args, or config		['config']	No
	--show-config-format		Format for displaying computed config or arguments.	\(1\)	str	dict, yaml, or json	Depends on --show-config		No
	--help	-h	Display a help message and exit.	\(0\)					No
top_genes	--top-genes	-n	Number of top genes by k-mer coverate to select.	\(1\)	int				Yes
top_matches	--top-matches	-N	Threshold for counting a match between two genes.	\(1\)	int		\(1\)		Yes
transcripts_name	--transcripts-name	-t	Name of transcripts files in input directories.	\(1\)	str		transcripts.fasta		Yes
top_genes_dir	--top-genes-dir	-O1	Directory containing top n genes by coverage.	\(1\)	pathlib.Path		OUTPUT_DIR/od1		Yes
tables_dir	--tables-dir	-O2	Directory containing gene matches tables.	\(1\)	pathlib.Path		OUTPUT_DIR/od2		Yes
transcript_id_regex	--transcript-id-regex	-p	Python regex to use for parsing transcript IDs.	\(1\)	re.Pattern		^.*cov_([0-9]+(?:\.[0-9]+))_g([0-9]+)_i([0-9]+)		Yes
evalue	--evalue	-e	e-value threshold to use for BLASTn searches.	\(1\)	float		\(1 \times 10^{-99}\)		Yes
jobs	--jobs	-j	Number of parallel jobs to use.	\(1\)	int		THREADS - 1		Yes
cache_dir	--cache-dir	-C	Directory containing BLAST DB caches.	\(1\)	pathlib.Path		OUTPUT_DIR/db_cache		Yes
graph	--graph	-g	Gene matches graph.	\(1\)	pathlib.Path		OUTPUT_DIR/graph.pkl		Yes
output_dir	--output-dir	-O	RNA-clique analysis output root directory.	\(1\)	pathlib.Path				No
title	--title	-T	Name to assign to the analysis.	\(1\)	str		OUTPUT_DIR.name		No
keep_all	--no-keep-all		Do not keep all matches in case of a tie.	\(0\)	bool		True	False	No
	--output-config	-c2	File in which to store computed config after analysis.	\(1\)	pathlib.Path		OUTPUT_DIR/config.yaml		No
matrix	--matrix	-m	Output distance matrix location.	\(1\)	pathlib.Path		OUTPUT_DIR/distance_matrix.h5		No
verbose	--verbose	-v	Print more output than usual.	\(0\)	bool		False	True	No

Input format

This script's inputs are the transcriptomes to analyze.

Output format

The main output of this script is the distance matrix. In the process of obtaining the distance matrix, rna-clique also produces the top genes files, gene matches tables, and gene matches graph.

Examples

Run RNA-clique on the transcriptomes at sample1, sample2, and sample3. RNA-clique expects that the transcriptome FASTA files for these samples are located at sample1/transcripts.fasta, sample2/transcripts.fasta, and sample3/transcripts.fasta, respectively. Select only the top \(5000\) genes by \(k\)-mer coverage for each sample. Write output under rna_clique_out.

rna-clique sample1 sample2 sample3 -n 50000 -O rna_clique_out

Run RNA-clique on the transcriptomes at sample1, sample2, sample3, and sample4. Expect that the transcriptome FASTA files for these samples will be at sample1/genes.fasta, sample2/genes.fasta, sample3/genes.fasta, and sample4/genes.fasta, respectively. Use an \(e\)-value cutoff of \(1 \times 10^{-90}\). Dont' keep all matches in the case of ties when computing the gene matches tables; split ties arbitrarily. Select the top \(10000\) genens by \(k\)-mer coverage. Write the output gene matches graph to gene_matches_graph.pkl. Write the output distance matrix to matrix.h5. Write the remaining output under other_out.

rna-clique sample1 sample2 sample3 sample4 \
           -t genes.fasta --no-keep-all -n 10000 -O other_out \
           -g gene_matches_graph.pkl -m matrix.h5

build_graph

Build the gene matches graph from the gene matches tables.

Options

Config option	Long name	Short name	Description	Argument count	Type	Choices	Default value	Default value (flag only)	Required
	--input-config	-c	File from which to load configuration settings.	\(1\)	pathlib.Path		OUTPUT_DIR/config.yaml		No
	--show-config		Display the computed configuration or arguments.	\(\ge 0\)	list[str]	original_args, args, or config		['config']	No
	--show-config-format		Format for displaying computed config or arguments.	\(1\)	str	dict, yaml, or json	Depends on --show-config		No
	--help	-h	Display a help message and exit.	\(0\)					No
tables_dir	--tables-dir	-O2	Directory containing gene matches tables.	\(1\)	pathlib.Path		OUTPUT_DIR/od2		Yes
graph	--graph	-g	Gene matches graph.	\(1\)	pathlib.Path		OUTPUT_DIR/graph.pkl		Yes
output_dir	--output-dir	-O	RNA-clique analysis output root directory.	\(1\)	pathlib.Path				No
	--output-config	-c2	File in which to store computed config after analysis.	\(1\)	pathlib.Path		OUTPUT_DIR/config.yaml		No
verbose	--verbose	-v	Print more output than usual.	\(0\)	bool		False	True	No

Input format

The inputs for this script are the gene matches tables.

Output format

The output for this script is the gene matches graph.

Examples

Build a graph from tables in the RNA-clique analysis directory rna_clique_out. Tables are expected to be under rna_clique_out/od2. The output graph will be at rna_clique_out/graph.pkl.

python -m rna_clique.build_graph -O rna_clique_out

Specify a directory containing tables and output graph destination explicitly:

python -m rna_clique.build_graph --tables-dir tables/ \
                                 --graph gene_matches_graph.pkl

export_and_search

Export orthologs from ideal components and search their sequences with BLAST.

This script combines functionality from export_graph and search_ideal_components, but unlike those scripts, this script can operate on multiple RNA-clique analyses and multiple queries at once. The analyses for which to export and search ideal components can be specified via their config files using the -C option.

Options

Long name	Short name	Description	Argument count	Type	Choices	Default value	Default value (flag only)	Required
--show-args		Display the computed or original parsed arguments.	\(\ge 0\)	list[str]	original_args or args		['args']	No
--show-args-format		Format for displaying computed or original parsed arguments.	\(1\)	str	dict, yaml, or json	Depends on --show-args		No
--help	-h	Display a help message and exit.	\(0\)					No
--configs	-C	RNA-clique configs for which to export and search orthologs.	\(\ge 1\)	list[pathlib.Path]				Yes
--resolve-name-conflicts	-r	Resolve conflicting output filenames automatically.	\(0\)				True	No
--export-output-dir	-X	Output directory for exported sequences.	\(1\)	pathlib.Path				Yes
--jobs	-j	Number of parallel jobs to use.	\(1\)	int				No
--export-only	-x	Only export the orthologs; don't search.	\(0\)				True	No
--queries	-Q	FASTA files containing sequences to search in orthologs.	\(\ge 1\)	list[pathlib.Path]				No
--transcript-id-regex	-p	Python regex for parsing sequence IDs	\(1\)	re.<function compile at 0x76cbc12eb2e0>		re.compile('^.*cov_([0-9]+(?:\\.[0-9]+))_g([0-9]+)_i([0-9]+)')		No
--extended-search-evalue	-E	Search other isoforms of a gene that produces a hit.	\(0--1\)	float			\(1 \times 10^{-20}\)	No
--search-evalue	-e	e-value cutoff to use for initial searches.	\(1\)	float		\(1 \times 10^{-50}\)		No
--verbose	-v	Print more output than ususal.	\(0\)				True	No

Input format

The inputs for this script are configuration files (representing RNA-clique analyses) and query nucleotide sequences in FASTA format. Each configuration file must provide the graph and tables_dir for the analysis.

Output format

Directory structure

The exported orthologs and search results for an analysis are placed under a subdirectory of the provided export output directory (--export-output-dir). This subdirectory is ordinarily named after title of the analysis (title), or else the name of the analysis root directory (out_dir). If a config file specifies neither a title nor an out_dir, export_and_search will fail.

In the case that multiple analyses have the same name, the script will fail with an error message by default. To have the script instead rename the outputs automatically to avoid conflicting analysis names, the --resolve-name-conflict option can be provided.

Exported orthologs for an analysis are placed in a directory named export within the analysis's directory under the --export-output-dir directory. See the output format section for export_orthologs for a more detailed description of the structure out these export directories.

BLAST results and statistics for each provided query FASTA file are placed in separate subdirectories beginning with search_ under the analysis's directory. The structure of these directories is described in the output format section for search_ideal_compoenents.

In some cases, parameters that can be provided to export_orthologs or search_ideal_components affect the output directory structure but are preset in export_and_search. See the Settings for export and search parameters section for details about these presets.

File format

The file format for the exported orthologs is described in the output format section for export_orthologs, and the file format for the search results is described in the output format section for search_ideal_components.

In some cases, parameters that can be provided to export_orthologs or search_ideal_components affect the output format but are preset in export_and_search. See the Settings for export and search parameters section for details about these presets.

Settings for export and search parameters

To simplify its usage, export_and_search does not support some options accepted by export_orthologs and search_ideal_components. Importantly, export_and_search does not allow the user to specify how orthologs should be grouped into files (normally specified using the --by option to export_orthologs); export_and_search always groups by ideal component. export_and_search also always tries to put all transcripts belonging to genes in an ideal component in the same orientation (the default behavior for export_orthologs) and will attempt to fix orthologs using an inexact MaxSAT based method if the naive approach fails (behaving as though --allow-inconsistent were provided).

export_and_search appends the original sequence name after the ideal component ID (like --concat-id-order after) and always removes ideal components where there are no differences (like `--remove-non-contributing).

export_and_search creates the combined all_ideal.fasta file with all sequences from ideal components (similar to the --all option of export_orthologs) only when a search is to be performed. If --export-only has been specified, no search is performed, and, thus, the program does not create all_ideal.fasta.

Additionally, export_and_search always merges SAM files for alignments beloning to different isoforms of the same gene into a single SAM file, behaving as if --merge-sams were provided to search_ideal_components.

Unlike search_ideal_components, export_and_search does not support deleting the BLAST databases created for exported orthologs via a --clean option. If the BLAST databases created under export/db_cache are no longer valid (for example, because the export RNA-clique analysis was redone with different parameters since the databases were created), the directory must be deleted before running export_and_search.

Examples

Export orthologs from the analyses specified in analysis1/config.yml, analysis2/config.yml, named analysisA and analysisB, respectively. Results will be in export_out/analysisA and export_out/analysisB.

python -m rna_clique.export_and_search --export-only \
                                       -c analysis1/config.yml \
                                       analysis2/config.yml \
                                       -X export_out

Export orthologs from the analysis specified in analysis/config.yml, named myAnalysis, and search for sequences in to_search1.fasta and to_search2.fasta within the exported orthologs. Results will be in export_out/myAnalysis.

python -m rna_clique.export_and_search -c analysis/config.yml \
                                       analysis2/config.yml \
                                       -Q to_search1.fasta \
                                       to_search2.fasta \
                                       -X export_out

export_graph

Export a gene matches graph to another format.

Currently, this script supports the following formats:

• Cytoscape JSON
• GraphML
• Graphviz

Options

Config option	Long name	Short name	Description	Argument count	Type	Choices	Default value	Default value (flag only)	Required
	--input-config	-c	File from which to load configuration settings.	\(1\)	pathlib.Path		OUTPUT_DIR/config.yaml		No
	--show-config		Display the computed configuration or arguments.	\(\ge 0\)	list[str]	original_args, args, or config		['config']	No
	--show-config-format		Format for displaying computed config or arguments.	\(1\)	str	dict, yaml, or json	Depends on --show-config		No
	--help	-h	Display a help message and exit.	\(0\)					No
graph	--graph	-g	Gene matches graph.	\(1\)	pathlib.Path		OUTPUT_DIR/graph.pkl		Yes
output_dir	--output-dir	-A	RNA-clique analysis output root directory.	\(1\)	pathlib.Path				No
	--export-out	-x	Path to which to export the graph.	\(1\)	pathlib.Path				No
	--format	-f	Format for writing graph.	\(1\)	str	cytoscape, graphml, or graphviz	Depends on export_out		Yes
verbose	--verbose	-v	Print more output than usual.	\(0\)	bool		False	True	No

Input format

This script requires the gene matches graph as its input.

Graph export formats

Cytoscape JSON

Export to the Cytoscape JSON format used by Cytoscape.js.

Note

Despite the format's name, it is not compatible with the original Java-based Cytoscape desktop application. For exporting to Cytoscape, use GraphML instead.

Example

{
    "data": [],
    "directed": false,
    "multigraph": false,
    "elements": {
        "nodes": [
            {
                "data": {
                    "id": "('SRR6847395_out_top.fasta', 6)",
                    "value": [
                        "SRR6847395_out_top.fasta",
                        6
                    ],
                    "name": "('SRR6847395_out_top.fasta', 6)"
                }
            },
            {
                "data": {
                    "id": "('SRR6847395_out_top.fasta', 5289)",
                    "value": [
                        "SRR6847395_out_top.fasta",
                        5289
                    ],
                    "name": "('SRR6847395_out_top.fasta', 5289)"
                }
            },
            // ...
        ],
        "edges": [
            {
                "data": {
                    "source": [
                        "SRR6847395_out_top.fasta",
                        6
                    ],
                    "target": [
                        "SRR6847396_out_top.fasta",
                        0
                    ]
                }
            },
            {
                "data": {
                    "source": [
                        "SRR6847395_out_top.fasta",
                        5289
                    ],
                    "target": [
                        "SRR6847396_out_top.fasta",
                        48
                    ]
                }
            },
            // ...
        ]
    }
}

GraphML

Export to GraphML, an XML-based format for describing graphs.

Example

<?xml version='1.0' encoding='utf-8'?>
<graphml xmlns="http://graphml.graphdrawing.org/xmlns" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xsi:schemaLocation="http://graphml.graphdrawing.org/xmlns http://graphml.graphdrawing.org/xmlns/1.0/graphml.xsd">
  <graph edgedefault="undirected">
    <node id="('SRR6847395_out_top.fasta', 6)" />
    <node id="('SRR6847395_out_top.fasta', 5289)" />
    <node id="('SRR6847395_out_top.fasta', 1672)" />
    <!-- More nodes here ... -->
    <edge source="('SRR6847395_out_top.fasta', 6)" target="('SRR6847396_out_top.fasta', 0)" />
    <edge source="('SRR6847395_out_top.fasta', 5289)" target="('SRR6847396_out_top.fasta', 48)" />
    <edge source="('SRR6847395_out_top.fasta', 5289)" target="('SRR6847398_out_top.fasta', 2189)" />
    <!-- More edges here ... -->
  </graph>
</graphml>

Graphviz

Export the entire gene matches graph to a Graphviz ("dot") file. In principle, this file could be used to draw the full gene matches graph via one of the Graphviz layout programs (e.g., neato, circo, etc.), but, in practice, gene matches graphs are often too large to draw with Graphviz, even for small analyses involving only four samples.

The function is included in case plotting some subgraph might be useful. The Graphviz export may also be practical for analyses with only three samples, but this is untested.

Examples

Export the gene matches graph from an analysis at my_analysis to GraphML and write the result to standard output.

python -m rna_clique.export_graph -O my_analysis -f graphml

Export a graph located at analysis1/graph.pkl to Cytoscape JSON at export.json.

python -m rna_clique.export_graph -g analysis1/graph.pkl \
                                  -f cytoscape \
                                  -x export.json

export_matrix

Export a computed dissimilarity matrix to another format. By default, the matrix is exported to the standard output, but the matrix can be exported to a file instead using the --export-out option.

Currently, this script supports exporting to the following formats:

• Matrix
• Table
• CSV
• hdf
• pickle

Options

Config option	Long name	Short name	Description	Argument count	Type	Choices	Default value	Default value (flag only)	Required
	--input-config	-c	File from which to load configuration settings.	\(1\)	pathlib.Path		OUTPUT_DIR/config.yaml		No
	--show-config		Display the computed configuration or arguments.	\(\ge 0\)	list[str]	original_args, args, or config		['config']	No
	--show-config-format		Format for displaying computed config or arguments.	\(1\)	str	dict, yaml, or json	Depends on --show-config		No
	--help	-h	Display a help message and exit.	\(0\)					No
matrix	--matrix	-m	Output distance matrix location.	\(1\)	pathlib.Path		OUTPUT_DIR/distance_matrix.h5		Yes
output_dir	--output-dir	-O	RNA-clique analysis output root directory.	\(1\)	pathlib.Path				No
	--export-out	-x	Path to which to export the matrix.	\(1\)	pathlib.Path				No
	--format	-f	Format for writing distance matrix.	\(1\)	str	matrix, table, csv, hdf, or pickle	Dynamic		No
	--header		Include header in distance matrix written.	\(0\)				True	No
verbose	--verbose	-v	Print more output than usual.	\(0\)	bool		False	True	No

The --format option defaults to matrix when writing to standard output. When --export-out is provided, export_matrix tries to determine the output format from the output file's file extension. If the file extension is not recongized by export_matrix, the format again defaults to matrix.

Input format

This script expects the distance matrix as input.

Matrix export formats

By default, the matrix is written to standard output. When --export-out is provided, the matrix is written to a file at the given path instead.

Matrix

The matrix format produces a 2D space-separated array of floating-point values. The orders of samples in the rows and columns are the same, but neither rows nor columns are labeled in the matrix format. To get labels on the rows and columns, use the table format instead.

Example

0.0 0.005388803504220092 0.0054305311443104045 0.005459213437854515 0.005512249049959638 0.005736910464039689 0.00747255775698311 0.007539593449521158 0.007182140678310776 0.007276675683252087 0.007248347134681538 0.007283538806219465 0.00762743569213341 0.00743863245673041 0.007230214862207701 0.0073832767780768254
0.005388803504220092 0.0 0.005444154410878668 0.005457044881951446 0.005509492270546363 0.005524904289722484 0.007358911632464738 0.00734145312059913 0.007178641884408139 0.007222263591986068 0.007299566949444612 0.007294928786675735 0.007656986703430995 0.0073262905661900446 0.007408281261711856 0.007638552765508823
0.0054305311443104045 0.005444154410878668 0.0 0.005693270624845291 0.005504512466459697 0.005623807465660282 0.007460847632579519 0.007338287207960742 0.007026428740023054 0.007345203662465187 0.007298558140709513 0.007255076165936527 0.007773889001222752 0.007491181297100733 0.007461249801562505 0.007582443616558755
0.005459213437854515 0.005457044881951446 0.005693270624845291 0.0 0.005382294872687209 0.005624631102239679 0.007461600494472286 0.0075545366408871035 0.00722308988794688 0.007302489419096259 0.007593104402212075 0.007312652480260233 0.007717985706596547 0.007298352807919292 0.007431485603066781 0.007506446547060221
0.005512249049959638 0.005509492270546363 0.005504512466459697 0.005382294872687209 0.0 0.005408467697660717 0.007469933549435503 0.00747932919860101 0.0071926795719216485 0.007245129665339076 0.007446632250291478 0.007292153397566585 0.0075851662624996236 0.007313530586610903 0.007327216346131236 0.007692388221551249
0.005736910464039689 0.005524904289722484 0.005623807465660282 0.005624631102239679 0.005408467697660717 0.0 0.007555198645292785 0.007452169760737729 0.007267972973651089 0.00728552657657327 0.007427030130130788 0.007357451543864015 0.007678875003598042 0.007341109656108671 0.007358340294100507 0.007776166721858891
0.00747255775698311 0.007358911632464738 0.007460847632579519 0.007461600494472286 0.007469933549435503 0.007555198645292785 0.0 0.005588505140222338 0.0072828077441650175 0.0072497139542041485 0.007404599487716344 0.007604547828924467 0.00788919346350089 0.007324928371612728 0.00723491884565872 0.007607016896798138
0.007539593449521158 0.00734145312059913 0.007338287207960742 0.0075545366408871035 0.00747932919860101 0.007452169760737729 0.005588505140222338 0.0 0.007301401193487594 0.007086699780622347 0.007402177949342384 0.007471282891062408 0.007883648522377027 0.007332780007601444 0.007302255769002343 0.007709591684544236
0.007182140678310776 0.007178641884408139 0.007026428740023054 0.00722308988794688 0.0071926795719216485 0.007267972973651089 0.0072828077441650175 0.007301401193487594 0.0 0.005540287068859703 0.0072693817846589395 0.007325561099070532 0.007543946579835303 0.007294093624627043 0.007345516049973433 0.007336003543873897
0.007276675683252087 0.007222263591986068 0.007345203662465187 0.007302489419096259 0.007245129665339076 0.00728552657657327 0.0072497139542041485 0.007086699780622347 0.005540287068859703 0.0 0.007391276328118516 0.007457925962836311 0.0077668702857649685 0.007315902653215641 0.007282014518250357 0.007465439374296728
0.007248347134681538 0.007299566949444612 0.007298558140709513 0.007593104402212075 0.007446632250291478 0.007427030130130788 0.007404599487716344 0.007402177949342384 0.0072693817846589395 0.007391276328118516 0.0 0.005707789174069651 0.006126693346289233 0.005851743283501044 0.005801252770533637 0.005964403443675155
0.007283538806219465 0.007294928786675735 0.007255076165936527 0.007312652480260233 0.007292153397566585 0.007357451543864015 0.007604547828924467 0.007471282891062408 0.007325561099070532 0.007457925962836311 0.005707789174069651 0.0 0.00588497358210044 0.005482496045834437 0.005388058635962769 0.005730100739785911
0.00762743569213341 0.007656986703430995 0.007773889001222752 0.007717985706596547 0.0075851662624996236 0.007678875003598042 0.00788919346350089 0.007883648522377027 0.007543946579835303 0.0077668702857649685 0.006126693346289233 0.00588497358210044 0.0 0.0058109335333090244 0.00607229411236707 0.005964136017753867
0.00743863245673041 0.0073262905661900446 0.007491181297100733 0.007298352807919292 0.007313530586610903 0.007341109656108671 0.007324928371612728 0.007332780007601444 0.007294093624627043 0.007315902653215641 0.005851743283501044 0.005482496045834437 0.0058109335333090244 0.0 0.005699313542929577 0.005701078777889641
0.007230214862207701 0.007408281261711856 0.007461249801562505 0.007431485603066781 0.007327216346131236 0.007358340294100507 0.00723491884565872 0.007302255769002343 0.007345516049973433 0.007282014518250357 0.005801252770533637 0.005388058635962769 0.00607229411236707 0.005699313542929577 0.0 0.005664813883747902
0.0073832767780768254 0.007638552765508823 0.007582443616558755 0.007506446547060221 0.007692388221551249 0.007776166721858891 0.007607016896798138 0.007709591684544236 0.007336003543873897 0.007465439374296728 0.005964403443675155 0.005730100739785911 0.005964136017753867 0.005701078777889641 0.005664813883747902 0.0

Table

The table format produces a 2D space-separated array of floating-point values with labeled rows. The orders of samples in the rows and columns are the same, so column labels are not necessary. To get labels on the columns as well, provide the --header flag.

To omit labels altogether, use the matrix format instead.

Example

rnac_out/od1/SRR2321383_top.fasta 0.0 0.005388803504220092 0.0054305311443104045 0.005459213437854515 0.005512249049959638 0.005736910464039689 0.00747255775698311 0.007539593449521158 0.007182140678310776 0.007276675683252087 0.007248347134681538 0.007283538806219465 0.00762743569213341 0.00743863245673041 0.007230214862207701 0.0073832767780768254
rnac_out/od1/SRR2321384_top.fasta 0.005388803504220092 0.0 0.005444154410878668 0.005457044881951446 0.005509492270546363 0.005524904289722484 0.007358911632464738 0.00734145312059913 0.007178641884408139 0.007222263591986068 0.007299566949444612 0.007294928786675735 0.007656986703430995 0.0073262905661900446 0.007408281261711856 0.007638552765508823
rnac_out/od1/SRR2321385_top.fasta 0.0054305311443104045 0.005444154410878668 0.0 0.005693270624845291 0.005504512466459697 0.005623807465660282 0.007460847632579519 0.007338287207960742 0.007026428740023054 0.007345203662465187 0.007298558140709513 0.007255076165936527 0.007773889001222752 0.007491181297100733 0.007461249801562505 0.007582443616558755
rnac_out/od1/SRR2321386_top.fasta 0.005459213437854515 0.005457044881951446 0.005693270624845291 0.0 0.005382294872687209 0.005624631102239679 0.007461600494472286 0.0075545366408871035 0.00722308988794688 0.007302489419096259 0.007593104402212075 0.007312652480260233 0.007717985706596547 0.007298352807919292 0.007431485603066781 0.007506446547060221
rnac_out/od1/SRR2321387_top.fasta 0.005512249049959638 0.005509492270546363 0.005504512466459697 0.005382294872687209 0.0 0.005408467697660717 0.007469933549435503 0.00747932919860101 0.0071926795719216485 0.007245129665339076 0.007446632250291478 0.007292153397566585 0.0075851662624996236 0.007313530586610903 0.007327216346131236 0.007692388221551249
rnac_out/od1/SRR2321388_top.fasta 0.005736910464039689 0.005524904289722484 0.005623807465660282 0.005624631102239679 0.005408467697660717 0.0 0.007555198645292785 0.007452169760737729 0.007267972973651089 0.00728552657657327 0.007427030130130788 0.007357451543864015 0.007678875003598042 0.007341109656108671 0.007358340294100507 0.007776166721858891
rnac_out/od1/SRR7990321_top.fasta 0.00747255775698311 0.007358911632464738 0.007460847632579519 0.007461600494472286 0.007469933549435503 0.007555198645292785 0.0 0.005588505140222338 0.0072828077441650175 0.0072497139542041485 0.007404599487716344 0.007604547828924467 0.00788919346350089 0.007324928371612728 0.00723491884565872 0.007607016896798138
rnac_out/od1/SRR7990322_top.fasta 0.007539593449521158 0.00734145312059913 0.007338287207960742 0.0075545366408871035 0.00747932919860101 0.007452169760737729 0.005588505140222338 0.0 0.007301401193487594 0.007086699780622347 0.007402177949342384 0.007471282891062408 0.007883648522377027 0.007332780007601444 0.007302255769002343 0.007709591684544236
rnac_out/od1/SRR8003736_top.fasta 0.007182140678310776 0.007178641884408139 0.007026428740023054 0.00722308988794688 0.0071926795719216485 0.007267972973651089 0.0072828077441650175 0.007301401193487594 0.0 0.005540287068859703 0.0072693817846589395 0.007325561099070532 0.007543946579835303 0.007294093624627043 0.007345516049973433 0.007336003543873897
rnac_out/od1/SRR8003737_top.fasta 0.007276675683252087 0.007222263591986068 0.007345203662465187 0.007302489419096259 0.007245129665339076 0.00728552657657327 0.0072497139542041485 0.007086699780622347 0.005540287068859703 0.0 0.007391276328118516 0.007457925962836311 0.0077668702857649685 0.007315902653215641 0.007282014518250357 0.007465439374296728
rnac_out/od1/SRR8003753_top.fasta 0.007248347134681538 0.007299566949444612 0.007298558140709513 0.007593104402212075 0.007446632250291478 0.007427030130130788 0.007404599487716344 0.007402177949342384 0.0072693817846589395 0.007391276328118516 0.0 0.005707789174069651 0.006126693346289233 0.005851743283501044 0.005801252770533637 0.005964403443675155
rnac_out/od1/SRR8003754_top.fasta 0.007283538806219465 0.007294928786675735 0.007255076165936527 0.007312652480260233 0.007292153397566585 0.007357451543864015 0.007604547828924467 0.007471282891062408 0.007325561099070532 0.007457925962836311 0.005707789174069651 0.0 0.00588497358210044 0.005482496045834437 0.005388058635962769 0.005730100739785911
rnac_out/od1/SRR8003755_top.fasta 0.00762743569213341 0.007656986703430995 0.007773889001222752 0.007717985706596547 0.0075851662624996236 0.007678875003598042 0.00788919346350089 0.007883648522377027 0.007543946579835303 0.0077668702857649685 0.006126693346289233 0.00588497358210044 0.0 0.0058109335333090244 0.00607229411236707 0.005964136017753867
rnac_out/od1/SRR8003756_top.fasta 0.00743863245673041 0.0073262905661900446 0.007491181297100733 0.007298352807919292 0.007313530586610903 0.007341109656108671 0.007324928371612728 0.007332780007601444 0.007294093624627043 0.007315902653215641 0.005851743283501044 0.005482496045834437 0.0058109335333090244 0.0 0.005699313542929577 0.005701078777889641
rnac_out/od1/SRR8003761_top.fasta 0.007230214862207701 0.007408281261711856 0.007461249801562505 0.007431485603066781 0.007327216346131236 0.007358340294100507 0.00723491884565872 0.007302255769002343 0.007345516049973433 0.007282014518250357 0.005801252770533637 0.005388058635962769 0.00607229411236707 0.005699313542929577 0.0 0.005664813883747902
rnac_out/od1/SRR8003762_top.fasta 0.0073832767780768254 0.007638552765508823 0.007582443616558755 0.007506446547060221 0.007692388221551249 0.007776166721858891 0.007607016896798138 0.007709591684544236 0.007336003543873897 0.007465439374296728 0.005964403443675155 0.005730100739785911 0.005964136017753867 0.005701078777889641 0.005664813883747902 0.0

CSV

The csv format produces a 2D comma-separated array of floating-point values with labeled rows. The orders of samples in the rows and columns are the same, so column labels are not necessary. To get labels on the columns as well, provide the --header flag.

Example

rnac_out/od1/SRR2321383_top.fasta,0.0,0.005388803504220092,0.0054305311443104045,0.005459213437854515,0.005512249049959638,0.005736910464039689,0.00747255775698311,0.007539593449521158,0.007182140678310776,0.007276675683252087,0.007248347134681538,0.007283538806219465,0.00762743569213341,0.00743863245673041,0.007230214862207701,0.0073832767780768254
rnac_out/od1/SRR2321384_top.fasta,0.005388803504220092,0.0,0.005444154410878668,0.005457044881951446,0.005509492270546363,0.005524904289722484,0.007358911632464738,0.00734145312059913,0.007178641884408139,0.007222263591986068,0.007299566949444612,0.007294928786675735,0.007656986703430995,0.0073262905661900446,0.007408281261711856,0.007638552765508823
rnac_out/od1/SRR2321385_top.fasta,0.0054305311443104045,0.005444154410878668,0.0,0.005693270624845291,0.005504512466459697,0.005623807465660282,0.007460847632579519,0.007338287207960742,0.007026428740023054,0.007345203662465187,0.007298558140709513,0.007255076165936527,0.007773889001222752,0.007491181297100733,0.007461249801562505,0.007582443616558755
rnac_out/od1/SRR2321386_top.fasta,0.005459213437854515,0.005457044881951446,0.005693270624845291,0.0,0.005382294872687209,0.005624631102239679,0.007461600494472286,0.0075545366408871035,0.00722308988794688,0.007302489419096259,0.007593104402212075,0.007312652480260233,0.007717985706596547,0.007298352807919292,0.007431485603066781,0.007506446547060221
rnac_out/od1/SRR2321387_top.fasta,0.005512249049959638,0.005509492270546363,0.005504512466459697,0.005382294872687209,0.0,0.005408467697660717,0.007469933549435503,0.00747932919860101,0.0071926795719216485,0.007245129665339076,0.007446632250291478,0.007292153397566585,0.0075851662624996236,0.007313530586610903,0.007327216346131236,0.007692388221551249
rnac_out/od1/SRR2321388_top.fasta,0.005736910464039689,0.005524904289722484,0.005623807465660282,0.005624631102239679,0.005408467697660717,0.0,0.007555198645292785,0.007452169760737729,0.007267972973651089,0.00728552657657327,0.007427030130130788,0.007357451543864015,0.007678875003598042,0.007341109656108671,0.007358340294100507,0.007776166721858891
rnac_out/od1/SRR7990321_top.fasta,0.00747255775698311,0.007358911632464738,0.007460847632579519,0.007461600494472286,0.007469933549435503,0.007555198645292785,0.0,0.005588505140222338,0.0072828077441650175,0.0072497139542041485,0.007404599487716344,0.007604547828924467,0.00788919346350089,0.007324928371612728,0.00723491884565872,0.007607016896798138
rnac_out/od1/SRR7990322_top.fasta,0.007539593449521158,0.00734145312059913,0.007338287207960742,0.0075545366408871035,0.00747932919860101,0.007452169760737729,0.005588505140222338,0.0,0.007301401193487594,0.007086699780622347,0.007402177949342384,0.007471282891062408,0.007883648522377027,0.007332780007601444,0.007302255769002343,0.007709591684544236
rnac_out/od1/SRR8003736_top.fasta,0.007182140678310776,0.007178641884408139,0.007026428740023054,0.00722308988794688,0.0071926795719216485,0.007267972973651089,0.0072828077441650175,0.007301401193487594,0.0,0.005540287068859703,0.0072693817846589395,0.007325561099070532,0.007543946579835303,0.007294093624627043,0.007345516049973433,0.007336003543873897
rnac_out/od1/SRR8003737_top.fasta,0.007276675683252087,0.007222263591986068,0.007345203662465187,0.007302489419096259,0.007245129665339076,0.00728552657657327,0.0072497139542041485,0.007086699780622347,0.005540287068859703,0.0,0.007391276328118516,0.007457925962836311,0.0077668702857649685,0.007315902653215641,0.007282014518250357,0.007465439374296728
rnac_out/od1/SRR8003753_top.fasta,0.007248347134681538,0.007299566949444612,0.007298558140709513,0.007593104402212075,0.007446632250291478,0.007427030130130788,0.007404599487716344,0.007402177949342384,0.0072693817846589395,0.007391276328118516,0.0,0.005707789174069651,0.006126693346289233,0.005851743283501044,0.005801252770533637,0.005964403443675155
rnac_out/od1/SRR8003754_top.fasta,0.007283538806219465,0.007294928786675735,0.007255076165936527,0.007312652480260233,0.007292153397566585,0.007357451543864015,0.007604547828924467,0.007471282891062408,0.007325561099070532,0.007457925962836311,0.005707789174069651,0.0,0.00588497358210044,0.005482496045834437,0.005388058635962769,0.005730100739785911
rnac_out/od1/SRR8003755_top.fasta,0.00762743569213341,0.007656986703430995,0.007773889001222752,0.007717985706596547,0.0075851662624996236,0.007678875003598042,0.00788919346350089,0.007883648522377027,0.007543946579835303,0.0077668702857649685,0.006126693346289233,0.00588497358210044,0.0,0.0058109335333090244,0.00607229411236707,0.005964136017753867
rnac_out/od1/SRR8003756_top.fasta,0.00743863245673041,0.0073262905661900446,0.007491181297100733,0.007298352807919292,0.007313530586610903,0.007341109656108671,0.007324928371612728,0.007332780007601444,0.007294093624627043,0.007315902653215641,0.005851743283501044,0.005482496045834437,0.0058109335333090244,0.0,0.005699313542929577,0.005701078777889641
rnac_out/od1/SRR8003761_top.fasta,0.007230214862207701,0.007408281261711856,0.007461249801562505,0.007431485603066781,0.007327216346131236,0.007358340294100507,0.00723491884565872,0.007302255769002343,0.007345516049973433,0.007282014518250357,0.005801252770533637,0.005388058635962769,0.00607229411236707,0.005699313542929577,0.0,0.005664813883747902
rnac_out/od1/SRR8003762_top.fasta,0.0073832767780768254,0.007638552765508823,0.007582443616558755,0.007506446547060221,0.007692388221551249,0.007776166721858891,0.007607016896798138,0.007709591684544236,0.007336003543873897,0.007465439374296728,0.005964403443675155,0.005730100739785911,0.005964136017753867,0.005701078777889641,0.005664813883747902,0.0

HDF

The hdf format produces a binary HDF5 store with a single key, matrix, containing the matrix stored as an HDF5 group in the fixed format used by Pandas. This is the same format used by default for the input distance matrix.

Pickle

The pickle format produces a binary serialized representation of the distance matrix Pandas dataframe in the format used by Python's Pickle virtual machine.

Examples

Export the distance matrix for the analysis located at my_analysis to a space-separated table with labels for both rows and columns, writing to standard output.

python -m rna_clique.export_matrix -O my_analysis -f table --header

Export the distance matrix located at analysis1/matrix.h5 to a Python pickle file saved at matrix.pkl.

python -m rna_clique.export_matrix -m analysis1/matrix.h5 \
                                   -f pickle \
                                   -x matrix.pkl

export_orthologs

Export ortholog sequences from ideal components for a single RNA-clique analysis.

This script exports the sequences of all isoforms belonging to genes found in ideal components. How to organize these sequences can be controlled via the command-line options.

If you wish to export orthologs for multiple analyses with typical settings or would like to search exported orthologs using typical settings, you may prefer to use export_and_search.

Options

Config option	Long name	Short name	Description	Argument count	Type	Choices	Default value	Default value (flag only)	Required
	--input-config	-c	File from which to load configuration settings.	\(1\)	pathlib.Path		OUTPUT_DIR/config.yaml		No
	--show-config		Display the computed configuration or arguments.	\(\ge 0\)	list[str]	original_args, args, or config		['config']	No
	--show-config-format		Format for displaying computed config or arguments.	\(1\)	str	dict, yaml, or json	Depends on --show-config		No
	--help	-h	Display a help message and exit.	\(0\)					No
graph	--graph	-g	Gene matches graph.	\(1\)	pathlib.Path		OUTPUT_DIR/graph.pkl		Yes
tables_dir	--tables-dir	-O2	Directory containing gene matches tables.	\(1\)	pathlib.Path		OUTPUT_DIR/od2		Yes
jobs	--jobs	-j	Number of parallel jobs to use.	\(1\)	int		THREADS - 1		Yes
transcript_id_regex	--transcript-id-regex	-p	Python regex to use for parsing transcript IDs.	\(1\)	re.Pattern		^.*cov_([0-9]+(?:\.[0-9]+))_g([0-9]+)_i([0-9]+)		Yes
output_dir	--output-dir	-A	RNA-clique analysis root.	\(1\)	pathlib.Path				No
	--export-output-dir	-X	Output directory in which to store exported orthologs.	\(1\)	pathlib.Path				Yes
	--by	-b	Attribute by which to organize orthologs in export.	\(1\)	str	sample or component	sample		No
	--remove-non-contributing	-N	Remove ideal components that contribute no differences.	\(0\)				True	No
	--debug		Enable debug behavior.	\(0\)				True	No
	--concat-id-order	-o	Where to place original sequence ID relative to group name.	\(1\)	str	before or after	after		No
	--no-fix-strand		Do not attempt to put transcripts in consistent orientations.	\(0\)				True	No
	--allow-inconsistent	-i	Approximate transcript reorientation instead of failing.	\(0\)				True	No
	--all	-a	Create combined all_ideal.fasta file.	\(0\)				True	No
verbose	--verbose	-v	Print more output than usual.	\(0\)	bool		False	True	No

by

The --by option changes the way in which the output orthologs are organized into files. The are currently two ways to organize the output orthologs—by sample or by component.

sample

If orthologs are exported by sample, then each output file contains all transcript isoforms of all genes in ideal components for a single sample. For each exported transcript, the ideal component to which each transcript's gene belongs is added to the transcript's FASTA sequence header, allowing identification of corresponding orthologs across multiple samples. Transcripts are sorted by their ideal component IDs in every file, facilitating comparison across multiple samples.

>-NODE_11_length_11173_cov_10.655520_g5_i0:ideal_component_0
GTCGGAACCGAGCACTGCTAGACGAGTTGGAGTGGCACCAGACATTGCAAGGAATCTGCA
...
>NODE_12_length_11173_cov_10.643563_g5_i1:ideal_component_0
CGGAACCGAGCACTGCTAGACGAGTTGGAGGCACCAGACTTTGCAACAAATCTGCACTAA
...
>NODE_1_length_15341_cov_25.030735_g0_i0:ideal_component_1
CGGAGACCCACAGACTCGTACTGAAGACCAAACGAACACCATCCGTAGGGGTTCAAAATG
...

component

If orthologs are exported by component, then each output file contains all transcript isoforms of all genes in a single ideal component. For each exported transcript, the sample to which the transcript belongs is added to the transcript's FASTA sequence header.

>-NODE_1_length_15383_cov_32.255511_g0_i0:SRR2321385
CGGAGCCCGCTGGAGCCGGCGCCGTCCTCGCTGCGGCCCGCGCGGTCGTCTCCACCGTCC
...
>NODE_3959_length_2941_cov_7.131397_g0_i1:SRR2321385
CGGAGCCCGCTGGAGCCGGCGCCGTCCTCGCTGCGGCCCGCGCGGTCGTCTCCACCGTCC
...
>-NODE_5_length_12142_cov_36.058215_g2_i0:SRR2321386
TTGAAGTGCCTGTTACGTGGATTTCCATCAGAGTACACTTCTAGCAACAATACTCTTCTT
...

Input format

The inputs to this script are the gene matches tables and gene matches graph.

Output format

Directory structure

export_orthologs organizes the output transcripts into multiple files; how the output files are organized is specified using the --by parameter. Optionally, when --all is specified, this script will also produce an all_ideal.fasta file containing all of the output transcripts from the other files. Such a file is useful for searching with BLAST. The all_ideal.fasta file should contain all of the exported transcripts from ideal components. It differs from the file that would be produced by simply concatenating all of the other exported FASTA files in that the all_ideal.fasta file appends identifiers to each transcript's FASTA sequence header indicating in which file the sequence was originally found. For example, where an individual ideal component file ideal_component_0.fasta would have a sequence with FASTA header NODE_1_length_15383_cov_32.255511_g0_i0:SRR2321385, the same sequence would have the FASTA header NODE_1_length_15383_cov_32.255511_g0_i0:SRR2321385:ideal_component_0 in the all_ideal.fasta file.

When outputs are organized by component, the files are combined in increasing order of ideal component ID. When outputs are organized by sample, the files are combined in the order their corresponding samples appear in the rows or columns of the distance matrix.

File format

Transcripts are exported in FASTA format and are sourced from the input top genes. Exported transcripts retain the text in their original FASTA sequence headers, but the exporter also adds some extra information. What specific information is added depends on how the output is organized via the --by parameter. The added information is separated from the original FASTA header by a colon (:); whether the added information comes first or second can be controlled by the --concat-id-order parameter.

Additionally, if the exporter has placed all transcripts for each ideal component in the same orientation, transcripts for which the orientation has been altered relative to the input are prefixed with -. If the orientation of the output transcript is the same as it was in the input, no prefix is added.

Examples

Export orthologs from ideal components identified in the analysis located at my_analysis to a directory called export. Organize the results by component.

python -m rna_clique.export_orthologs -O my_analysis -X export -b component

Export orthologs from ideal components identified in the analysis located at my_analysis to a directory called export2. Organize the results by sample. Ignore ideal components where there are no differences in the aligned regions of the transcripts, and create a combined all_ideal.fasta file containing all of the other exported transcripts.

python -m rna_clique.export_orthologs -O my_analysis -X export2 -b sample -N -a

filtered_distance

Compute pairwise distances from gene matches tables and graph.

Options

Config option	Long name	Short name	Description	Argument count	Type	Choices	Default value	Default value (flag only)	Required
	--input-config	-c	File from which to load configuration settings.	\(1\)	pathlib.Path		OUTPUT_DIR/config.yaml		No
	--show-config		Display the computed configuration or arguments.	\(\ge 0\)	list[str]	original_args, args, or config		['config']	No
	--show-config-format		Format for displaying computed config or arguments.	\(1\)	str	dict, yaml, or json	Depends on --show-config		No
	--help	-h	Display a help message and exit.	\(0\)					No
graph	--graph	-g	Gene matches graph.	\(1\)	pathlib.Path		OUTPUT_DIR/graph.pkl		Yes
tables_dir	--tables-dir	-O2	Directory containing gene matches tables.	\(1\)	pathlib.Path		OUTPUT_DIR/od2		Yes
matrix	--matrix	-m	Output distance matrix location.	\(1\)	pathlib.Path		OUTPUT_DIR/distance_matrix.h5		Yes
output_dir	--output-dir	-O	RNA-clique analysis output root directory.	\(1\)	pathlib.Path				No
	--output-config	-c2	File in which to store computed config after analysis.	\(1\)	pathlib.Path		OUTPUT_DIR/config.yaml		No
verbose	--verbose	-v	Print more output than usual.	\(0\)	bool		False	True	No

Input format

The inputs to this script are the gene matches graph and gene matches tables.

Output format

The output of this script is the distance matrix.

Example

Compute a distance matrix using the gene matches graph and gene matches tables found under rna_clique_out/graph.pkl and rna_clique_out/od2, respectively. Write the matrix to rna_clique_out/distance_matrix.h5.

python -m rna_clique.filtered_distance -O rna_clique_out

Compute a distance matrix using the gene matches graph at graph.pkl and the gene matches tables under tables_dir. Write the matrix to matrix.h5.

python -m rna_clique.filtered_distance -g graph.pkl -O2 tables_dir -m matrix.h5

filtering_step

This script automates "phase 1" of RNA-clique in which the following steps occur:

1. The top \(n\) genes for each sample are selected by \(k\)-mer coverage.
2. The gene matches tables are found by executing a BLAST search for each pair of samples in both directions. (That is, for samples \(a\) and \(b\), we BLAST both \(a\) vs. \(b\) and \(b\) vs. \(a\).)
3. The gene matches graph is constructed from the gene matches tables.

Positional arguments

Position	Config option	Description	Argument count	Type
0	input_dirs	Directories containing the transcript FASTA files.	\(\ge 0\)	list[pathlib.Path]

Options

Config option	Long name	Short name	Description	Argument count	Type	Choices	Default value	Default value (flag only)	Required
	--input-config	-c	File from which to load configuration settings.	\(1\)	pathlib.Path		OUTPUT_DIR/config.yaml		No
	--show-config		Display the computed configuration or arguments.	\(\ge 0\)	list[str]	original_args, args, or config		['config']	No
	--show-config-format		Format for displaying computed config or arguments.	\(1\)	str	dict, yaml, or json	Depends on --show-config		No
	--help	-h	Display a help message and exit.	\(0\)					No
top_genes	--top-genes	-n	Number of top genes by k-mer coverate to select.	\(1\)	int				Yes
top_matches	--top-matches	-N	Threshold for counting a match between two genes.	\(1\)	int		\(1\)		Yes
transcripts_name	--transcripts-name	-t	Name of transcripts files in input directories.	\(1\)	str		transcripts.fasta		Yes
top_genes_dir	--top-genes-dir	-O1	Directory containing top n genes by coverage.	\(1\)	pathlib.Path		OUTPUT_DIR/od1		Yes
tables_dir	--tables-dir	-O2	Directory containing gene matches tables.	\(1\)	pathlib.Path		OUTPUT_DIR/od2		Yes
transcript_id_regex	--transcript-id-regex	-p	Python regex to use for parsing transcript IDs.	\(1\)	re.Pattern		^.*cov_([0-9]+(?:\.[0-9]+))_g([0-9]+)_i([0-9]+)		Yes
evalue	--evalue	-e	e-value threshold to use for BLASTn searches.	\(1\)	float		\(1 \times 10^{-99}\)		Yes
jobs	--jobs	-j	Number of parallel jobs to use.	\(1\)	int		THREADS - 1		Yes
cache_dir	--cache-dir	-C	Directory containing BLAST DB caches.	\(1\)	pathlib.Path		OUTPUT_DIR/db_cache		Yes
graph	--graph	-g	Gene matches graph.	\(1\)	pathlib.Path		OUTPUT_DIR/graph.pkl		Yes
output_dir	--output-dir	-O	RNA-clique analysis output root directory.	\(1\)	pathlib.Path				No
title	--title	-T	Name to assign to the analysis.	\(1\)	str		OUTPUT_DIR.name		No
keep_all	--no-keep-all		Do not keep all matches in case of a tie.	\(0\)	bool		True	False	No
	--output-config	-c2	File in which to store computed config after analysis.	\(1\)	pathlib.Path		OUTPUT_DIR/config.yaml		No
verbose	--verbose	-v	Print more output than usual.	\(0\)	bool		False	True	No

Input format

The inputs to this script are the transcriptomes.

Output format

The outputs of this script are the top genes, gene matches tables, and the gene matches graph.

Examples

Complete phase 1 of RNA-clique for input files located under input1, input2, and input3. Input transcriptomes are assumed to be named transcripts.fasta, so the actual input transcriptomes are located at input1/transcripts.fasta, inputs2/transcripts.fasta, and input3/transcripts.fasta. The samples' names are assumed to be the directory names, input1, input2, and input3. Write the top genes, gene matches tables, and graph under the my_analysis directory.

Top genes will be under my_analysis/od1; the top genes for input1, input2, and input3 will be located at my_analysis/od1/input1_top.fasta, my_analysis/od2/input2_top.fasta, and my_analysis/od1/input3_top.fasta, respectively.

Gene matches tables for each pair of samples will be under my_analysis/od2. The files will be my_analysis/od2/input1--input2.h5, my_analysis_od2/input1--input3.h5, and my_analysis/od2/input2--input3.h5, representing the comparisons between input1 and input2, input1 and input3, and input2 and input3, respectively.

The gene matches graph will be at my_analysis/graph.pkl.

python -m rna_clique.filtering_step -O my_analysis input1 input2 input3

Run phase 1 of RNA-clique for input files located at sample1, sample2, and sample3. Input transcriptomes are located at data.fasta, so the actual input transcriptomes are sample1/data.fasta, sample2/data.fasta, and sample3/data.fasta. In the case of ties when selecting pairs of genes with maximum bitscore for the gene matches tables, don't keep all pairs; instead, split the ties arbitrarily. Use \(10^{-50}\) for the e-value cutoff. Write the top genes under my_top_genes. Run with 10 parallel jobs. Write the gene matches tables under my_gene_matches_tables, and write the graph to my_gene_matches_graph.pkl. Write the intermediate BLAST DB cache to db_caches.

Top genes will be under my_top_genes. The top genes for sample1, sample2, and sample3 will be located at my_top_genes/sample1_top.fasta, my_top_genes/sample2_top.fasta, and my_top_genes/sample3_top.fasta, respectively.

Gene matches tables for each pair of samples will be under my_gene_matches_tables. The files will be my_gene_matches_tables/sample1--sample2.h5, my_gene_matches_tables/sample1--sample3.h5, my_gene_matches_tables/sample2--sample3.h5, representing the gene matches tables for sample1 and sample2, sample1 and sample3, and sample2 and sample3, respectively.

The gene matches graph will be at my_gene_matches_graph.pkl.

python -m rna_clique.filtering_step -O1 my_top_genes \
                                    -O2 my_gene_matches_tables \
                                    -g my_gene_matches_graph.pkl \
                                    --no-keep-all \
                                    -e 10e-50 \
                                    -j 10 \
                                    -C db_caches \
                                    sample1 sample2 sample3

find_all_pairs

This script calculates the gene matches tables for all pairs of samples by BLASTing each sample against every other.

Options

Config option	Long name	Short name	Description	Argument count	Type	Choices	Default value	Default value (flag only)	Required
	--input-config	-c	File from which to load configuration settings.	\(1\)	pathlib.Path		OUTPUT_DIR/config.yaml		No
	--show-config		Display the computed configuration or arguments.	\(\ge 0\)	list[str]	original_args, args, or config		['config']	No
	--show-config-format		Format for displaying computed config or arguments.	\(1\)	str	dict, yaml, or json	Depends on --show-config		No
	--help	-h	Display a help message and exit.	\(0\)					No
top_genes_dir	--top-genes-dir	-O1	Directory containing top n genes by coverage.	\(1\)	pathlib.Path		OUTPUT_DIR/od1		Yes
transcript_id_regex	--transcript-id-regex	-p	Python regex to use for parsing transcript IDs.	\(1\)	re.Pattern		^.*cov_([0-9]+(?:\.[0-9]+))_g([0-9]+)_i([0-9]+)		Yes
tables_dir	--tables-dir	-O2	Directory containing gene matches tables.	\(1\)	pathlib.Path		OUTPUT_DIR/od2		Yes
cache_dir	--cache-dir	-C	Directory containing BLAST DB caches.	\(1\)	pathlib.Path		OUTPUT_DIR/db_cache		No
evalue	--evalue	-e	e-value threshold to use for BLASTn searches.	\(1\)	float		\(1 \times 10^{-99}\)		No
title	--title	-T	Name to assign to the analysis.	\(1\)	str		OUTPUT_DIR.name		No
output_dir	--output-dir	-O	RNA-clique analysis output root directory.	\(1\)	pathlib.Path				No
	--sample-regex	-R	Python regex for parsing sample names	\(1\)	re.<function compile at 0x7893728eb2e0>		re.compile('^(.*?)_.*$')		No
	--output-config	-c2	File in which to store computed config after analysis.	\(1\)	pathlib.Path		OUTPUT_DIR/config.yaml		No
verbose	--verbose	-v	Print more output than usual.	\(0\)	bool		False	True	No

Input format

The inputs for this script are the top genes.

Output format

The outputs for this script are the gene matches tables.

Examples

Get gene matches tables for an RNA-clique analysis located at my_analysis. Top \(n\) genes by \(k\)-mer coverage are expected to be in my_analysis/od1. Gene matches tables will be written under my_analysis/od2

python -m rna_clique.find_all_pairs -O my_analysis

Get gene matches tables from top \(n\) genes located under my_top_genes_dir and write the gene matches tables under my_gene_matches_tables. Use an \(e\)-value cutoff of \(10^{-50}\). Write intermediate BLAST DB caches under db_caches.

python -m rna_clique.find_all_pairs -O1 my_top_genes_dir \
                                    -O2 my_gene_matches_tables \
                                    -C db_caches \
                                    -e 1e-50

find_homologs

This script computes a genetic similarity for a single pair of samples. By default, it also reports best matching pairs of genes between the two samples.

Warning: This script should not be used if you are analyzing more than two samples total! Use rna-clique instead!

Positional arguments

Position	Description	Argument count	Type
0	path to the (top n) transcripts for the first sample	\(1\)	pathlib.Path
1	path to the (top n) transcripts for the second sample	\(1\)	pathlib.Path

Options

Config option	Long name	Short name	Description	Argument count	Type	Choices	Default value	Default value (flag only)	Required
	--input-config	-c	File from which to load configuration settings.	\(1\)	pathlib.Path		OUTPUT_DIR/config.yaml		No
	--show-config		Display the computed configuration or arguments.	\(\ge 0\)	list[str]	original_args, args, or config		['config']	No
	--show-config-format		Format for displaying computed config or arguments.	\(1\)	str	dict, yaml, or json	Depends on --show-config		No
	--help	-h	Display a help message and exit.	\(0\)					No
transcript_id_regex	--transcript-id-regex	-p	Python regex to use for parsing transcript IDs.	\(1\)	re.Pattern		^.*cov_([0-9]+(?:\.[0-9]+))_g([0-9]+)_i([0-9]+)		Yes
evalue	--evalue	-e	e-value threshold to use for BLASTn searches.	\(1\)	float		\(1 \times 10^{-99}\)		Yes
top_matches	--top-matches	-N	Threshold for counting a match between two genes (big \(N\)).	\(1\)	int		\(1\)		Yes
keep_all	--keep-all		Keep all matches between genes in the case of ties.	\(0\)	bool		True	True	Yes
	--quiet	-q	hide the matches found	\(0\)				True	No
	--report-float	-f	report float instead of fraction	\(0\)				True	No
verbose	--verbose	-v	Print more output than usual.	\(0\)	bool		False	True	No

Input format

The inputs to this script should be the top genes FASTA files for exactly two samples.

Output format

Unless --quiet/-q has been specified, the output begins with a list of pairs of gene IDs of likely homologous gene pairs between the two input gene sets. The list of homologous gene pairs is followed by the unfiltered similarity between the two samples.

By default, the similarity is reported as an irreducible fraction to provide maximum precision. To report the similarity as a floating-point decimal number instead, provide the --report-float/-f option to this script.

Example

For brevity, not all pairs of homologous genes are shown in this example.

7223 9664
11196 11799
13208 10969
13305 32659
22491 21604
41294 51241
44115 56286
45706 74954
55553 67245
66369 49022
30993737/31217075

Examples

Find an unfiltered genetic distance between the transcripts in transcripts1.fasta and transcripts2.fasta. Show which pairs of genes in the two files appear to best match.

python -m rna_clique.find_homologs transcripts1.fasta transcripts2.fasta

Find an unfiltered genetic distance between the transcripts in transcripts1.fasta and transcripts2.fasta. Report the distance only, as a floating point number.

python -m rna_clique.find_homologs transcripts1.fasta transcripts2.fasta -q -f

make_subset

This script creates links to gene matches tables and a gene matches graph for a subset of samples from a previously completed run of phase 1 of RNA-clique. make_subset is useful when you want to compute distances for a subset of samples that you've already analyzed with RNA-clique. This script is typically much faster than re-running Phase 1 on a subset of the input FASTA files since this script does not need to repeat any of the BLAST searches from the prior analysis.

Options

Config option	Long name	Short name	Description	Argument count	Type	Choices	Default value	Default value (flag only)	Required
	--input-config	-c	File from which to load configuration settings.	\(1\)	pathlib.Path		OUTPUT_DIR/config.yaml		No
	--show-config		Display the computed configuration or arguments.	\(\ge 0\)	list[str]	original_args, args, or config		['config']	No
	--show-config-format		Format for displaying computed config or arguments.	\(1\)	str	dict, yaml, or json	Depends on --show-config		No
	--help	-h	Display a help message and exit.	\(0\)					No
tables_dir	--tables-dir	-O2	Directory containing gene matches tables.	\(1\)	pathlib.Path		OUTPUT_DIR/od2		Yes
graph	--graph	-g	Gene matches graph.	\(1\)	pathlib.Path		OUTPUT_DIR/graph.pkl		Yes
output_dir	--output-dir	-O	RNA-clique analysis output root directory.	\(1\)	pathlib.Path				No
title	--title	-T	Name to assign to the analysis.	\(1\)	str		OUTPUT_DIR.name		No
subset_of	--subset-of	-I	Path to analysis of which this is a subset.	\(1\)	pathlib.Path				Yes
	--exclude	-x	samples to exclude (default is none)	\(\ge 1\)	list[str]		[]		No
	--include	-y	samples to include (default is all)	\(\ge 1\)	list[str]		[]		No
	--include-regex	-Y	regular expression specifying which sample names to include	\(1\)	re.<function compile at 0x7893728eb2e0>				No
	--output-config	-c2	File in which to store computed config after analysis.	\(1\)	pathlib.Path		OUTPUT_DIR/config.yaml		No
	--include-file		file containing samples to include	\(1\)	pathlib.Path				No
	--exclude-file		file containing samples to exclude	\(1\)	pathlib.Path				No
	--show-included		show which samples would be included and exit	\(0\)				True	No
verbose	--verbose	-v	Print more output than usual.	\(0\)	bool		False	True	No

Output format

The symbolic links to the gene matches tables belonging to the subset are placed under the specified tables_dir, or an od2 subdirectory of the specified root output directory. The new gene matches graph is saved at the specified graph path, or in a file named graph.pkl directly under the root output directory.

Examples

Create an analysis for a subset of samples from the analysis described by my_analysis/config.yaml. Exclude samples named sample2 and sample4. Create the tables directory containing symlinks and the gene matches graph under my_subset.

python -m rna_clique.make_subset -I my_analysis/config.yaml \
                                 -O my_subset \
                                 -x sample2 sample4

Create an analysis for a subset of samples from the analysis described by my_analysis/config.yaml. Include only samples matching the regular expression sample.*2. Create the samples directory containing symlinks at subset_tables and create the gene matches graph at subset_graph.pkl

python -m rna_clique.make_subset -I my_analysis/config.yaml \
                                 -O2 subset_tables \
                                 -g subset_graph.pkl
                                 -Y 'sample.*2'

plot_component_sizes

Despite its name, plot_component_sizes offers a variety of features useful for working with gene matches graphs:

• Visualizations
  • Component size histogram
  • Represented sample count histogram
  • Sample count to component size ratio KDE plot
  • Component density KDE plot
• Statistics
  • Ideal components
  • Large components
  • Total components

Options

Config option	Long name	Short name	Description	Argument count	Type	Choices	Default value	Default value (flag only)	Required
	--input-config	-c	File from which to load configuration settings.	\(1\)	pathlib.Path		OUTPUT_DIR/config.yaml		No
	--show-config		Display the computed configuration or arguments.	\(\ge 0\)	list[str]	original_args, args, or config		['config']	No
	--show-config-format		Format for displaying computed config or arguments.	\(1\)	str	dict, yaml, or json	Depends on --show-config		No
	--help	-h	Display a help message and exit.	\(0\)					No
graph	--graph	-g	Gene matches graph.	\(1\)	pathlib.Path		OUTPUT_DIR/graph.pkl		Yes
top_genes_dir	--top-genes-dir	-O1	Directory containing top n genes by coverage.	\(1\)	pathlib.Path		OUTPUT_DIR/od1		No
tables_dir	--tables-dir	-O2	Directory containing gene matches tables.	\(1\)	pathlib.Path		OUTPUT_DIR/od2		No
output_dir	--output-dir	-A	RNA-clique analysis output root directory.	\(1\)	pathlib.Path				No
	--size-plot	-s	output path for component size histogram	\(1\)	pathlib.Path				No
	--sample-plot	-S	output path for represented sample count plot	\(1\)	pathlib.Path				No
	--ratio-plot	-r	output path for KDE of represented sample count / component size	\(1\)	pathlib.Path				No
	--density-plot	-d	output path for KDE of component density	\(1\)	pathlib.Path				No
	--statistics		print statistics in the desired format (human or machine-readable)	\(0--1\)	str	h or m		h	No
verbose	--verbose	-v	Print more output than usual.	\(0\)	bool		False	True	No

Visualizations

plot_component_sizes can produce several different plots related to components of the gene matches graph.

Component size histogram

This plot shows the distribution of sizes among connected components of the gene matches graph.

For most sizes, the bar in the histogram is drawn in blue. For the case where the size is exactly the number of samples, the bar is drawn in orange. Since a gene must match some other gene to be included in the gene matches graph, no bar is shown for the case where the size is 1.

Represented sample count histogram

The number of samples represented in a connected component is the number of distinct samples to which genes in the component belong. For a given component, the number of represented samples is necessarily between 1 and the number of samples in the analysis.

This plot shows the distribution of number of represented samples among connected components in the gene matches graph.

For represented sample counts less than the number of samples , the bar in the histogram is drawn in blue. For the case where the represented sample count is exactly the number of samples, the bar is drawn in orange. Since a gene must match some other gene in another sample to be included in the gene matches graph, no bar is shown for the case where the represented sample count is 1.

Sample count to component size ratio KDE plot

This plot shows the distribution of represented samples divided by component size for the components in the gene matches graph. Since this ratio can take on many fractional values, kernel density estimation is used to plot the distribution.

Component density KDE plot

This plot shows the distribution of component density for the gene matches graph, where density is computed as the number of edges that exist in the component divided by the number of edges that would exist if the component were complete. Since the density can take on many fractional values, kernel density estimation is used to plot the distribution.

Output format

Figures can be saved in any format supported by the installed matplotlib's savefig function, which determines the format of the figure automatically from the file extension.

When statistics are enabled, the statistics printed are, in order,

1. Number of samples
2. Count of total connected components
3. Count of large components (those with at least as many vertices as there are samples)
4. Count of ideal components

In the "human-readable" format, these values are labeled and are separated by newlines. In the "machine-readable" format, these values are unlabeled and are separated by spaces.

Examples

Create plots of component size frequency, represented sample count frequency, ratio of sample count to component size frequency, and component density frequency at size.svg, sample_count.svg, ratio.svg, and density.svg, respectively, for the analysis rooted at my_analysis. Report statistics in human-readable format.

python -m rna_clique.plot_component_sizes -O my_analysis \
                                          -s size.svg \
                                          -S sample_cout.svg \
                                          -r ratio.svg \
                                          -d density.svg \
                                          --statistics

Create a density KDE plot at density.png for the gene matches graph at graph.pkl and top genes directory top_genes. Report statistics in a machine-readable format.

python -m rna_clique.plot_component_sizes -O1 top_genes \
                                          -g graph.pkl \
                                          -d density.png \
                                          --statistics m

search_ideal_components

BLAST search the nucleotide sequences of orthologous transcripts belonging to genes in ideal components.

This script can be used, for example, to determine whether some possible contaminant could be contributing to distances observed.

This script is designed to be used on output from export_orthologs, but it does more than simply perform a BLAST search on the exported ortholog sequences. This script can perform an "extended" search (--extended-search/-e), which automatically searches other isoforms of the same gene with relaxed parameters when a query sequences matches one isoform of a gene. The extended search is designed to find alignments between query sequences and other gene isoforms that might be missed by a single BLAST search. The extended search does not necessarily search all isoforms of a given gene; only those that are connected to the originally matches isoform(s) in the orientation graph are searched.

When a BLAST hit for a query sequence is found in one of the exported ortholog sequences, this script can also optionally export the ideal component to which the transcript belongs. To enable this behavior, provide the --export-components/-x command-line option.

If you would like to both export orthologs and search their sequences at once with typical settings, you may prefer to use export_and_search instead.

Options

Config option	Long name	Short name	Description	Argument count	Type	Choices	Default value	Default value (flag only)	Required
	--input-config	-c	File from which to load configuration settings.	\(1\)	pathlib.Path		OUTPUT_DIR/config.yaml		No
	--show-config		Display the computed configuration or arguments.	\(\ge 0\)	list[str]	original_args, args, or config		['config']	No
	--show-config-format		Format for displaying computed config or arguments.	\(1\)	str	dict, yaml, or json	Depends on --show-config		No
	--help	-h	Display a help message and exit.	\(0\)					No
graph	--graph	-g	Gene matches graph.	\(1\)	pathlib.Path		OUTPUT_DIR/graph.pkl		Yes
tables_dir	--tables-dir	-O2	Directory containing gene matches tables.	\(1\)	pathlib.Path		OUTPUT_DIR/od2		Yes
jobs	--jobs	-j	Number of parallel jobs to use.	\(1\)	int		THREADS - 1		Yes
transcript_id_regex	--transcript-id-regex	-p	Python regex to use for parsing transcript IDs.	\(1\)	re.Pattern		^.*cov_([0-9]+(?:\.[0-9]+))_g([0-9]+)_i([0-9]+)		Yes
output_dir	--output-dir	-A	RNA-clique analysis root (output_dir).	\(1\)	pathlib.Path				No
	--export-output-dir	-X	Directory containing exported orthologs to search.	\(1\)	pathlib.Path				No
	--all-ideal	-a	FASTA file containing all sequences from ideal components.	\(1\)	pathlib.Path		Depends on export_output_dir		Yes
	--ortholog-db-cache	-D	Directory in which to store BLAST databases for orthologs.	\(1\)	pathlib.Path		Depends on export_output_dir		No
	--search-output-dir	-S	Output directory in which to store BLAST results.	\(1\)	pathlib.Path				Yes
	--query	-q	FASTA file containing query sequences.	\(1\)	pathlib.Path				Yes
	--debug		Enable debug behavior.	\(0\)				True	No
	--clean		Delete existing BLAST DB cache before beginning search.	\(0\)				True	No
	--merge-sams	-m	Merge extended search results into one file.	\(0\)				True	No
	--extended-search	-e	Search other isoforms of a gene that produces a hit.	\(0\)				True	No
	--export-components	-x	Save matching orientation graph components in extended search.	\(0\)				True	No
verbose	--verbose	-v	Print more output than usual.	\(0\)	bool		False	True	No

Input format

This script expects as its input a single FASTA file containing all exported transcripts from ideal components. Since export_orthologs ordinarily separates exported transcripts into multiple files, it is necessary to provide the --all/-a command-line option to export_orthologs to combine the output files into an all_ideal.fasta file.

Output format

Directory structure

search_ideal_components places all of its output directly under a directory provided via the --search-output-dir/-S command-line option.

BLAST alignments for the initial search are saved as queries.sam. If an extended search is performed, the alignments of the query sequences against the other isoforms searched will be separate files for each isoform. The alignments matching isoform ISOFORMID of gene GENEID in sample SAMPLE are placed in SAMPLE_gGENEID_iISOFORMID.sam under the search output directory. If --merge-sams/-m has been provided, then all individual files from the extended search are also merged into graph.sam.

The full sequences of all matching isoforms (extracted from the input --all-ideal/-a file) are saved in subjects.fasta.

If --export-components/-x was provided, then all subgraphs of the orientation graph corresponding to ideal components where matches were found are written to the output directory. The orientation graph subgraph corresponding to ideal component INDEX is written to ideal_component_INDEX.graphml.

File format

All output files with the .sam file extension are alignments in Sequence Alignment Map (SAM) format. In the produced SAM files, the QNAME field values are names of input query sequences, and RNAME field values are names of transcripts from the input --all-ideal/-a FASTA file.

The subjects.fasta file contains sequences of transcripts sourced from the input --all-ideal/-a FASTA file, and subjects.fasta is likewise in FASTA format.

The exported ideal components with .graphml file extensions are in GraphML format.

Examples

Search orthologs for the analysis rna_clique_out, exported at at export/all_ideal.fasta, for sequences in queries.fasta. Write results under search_out.

python -m rna_clique.search_ideal_components -A rna_clique_out \
                                             -X export \
                                             -q queries.fasta \
                                             -S search_out

Perform an extended search for queries at queries.fasta in the orthologs exported from the analysis with gene matches graph graph.pkl and gene matches tables in tables_dir. Use the combined exported orthologs at combined.fasta, and put the BLAST DB cache for the search under db_cache. Perform an extended search. Merge results from extended searches into one file. Export the matches ideal components. Write the results under search_out.

python -m rna_clique.search_ideal_components -q queries.fasta \
                                             -g graph.pkl \
                                             -O2 tables_dir \
                                             -a combined.fasta \
                                             -D db_cache \
                                             -e -m -S search_out

select_top_genes

Select top \(n\) genes by \(k\)-mer coverage in a transcripts FASTA file and write them to the standard output. This gets only the genes best supported by RNA-seq reads.

select_top_genes takes the coverage of a gene to be the maximum coverage among the gene's isoforms. For example, suppose gene 10 has two isoforms. If gene 10 isoform 0 has coverage 10.0, and gene 10 isoform 1 has coverage 10.5, then the coverage of gene 10 is 10.5.

Although the top \(n\) genes are selected, genes are not sorted by \(k\)-mer coverage in the output.

select_top_genes always selects exactly \(\text{min}(n, |G|)\) genes, where \(|G|\) is the total number of genes. When there are \(c > 1\) genes with the same \(k\)-mer coverage \(\kappa\), and there are no more than \(n - c\) genes with \(k\)-mer coverage strictly less than \(\kappa\), all \(c\) genes will be included in the output. If there are more than \(n - c\) genes with \(k\)-mer coverage strictly less than \(\kappa\), then only of the \(n - d\) genes will be selected, where \(d\) is the number of genes with \(k\)-mer coverage strictly less than \(\kappa\). Which of the \(c\) genes are included is deterministic but arbitrary.

Options

Config option	Long name	Short name	Description	Argument count	Type	Choices	Default value	Default value (flag only)	Required
	--input-config	-c	File from which to load configuration settings.	\(1\)	pathlib.Path		OUTPUT_DIR/config.yaml		No
	--show-config		Display the computed configuration or arguments.	\(\ge 0\)	list[str]	original_args, args, or config		['config']	No
	--show-config-format		Format for displaying computed config or arguments.	\(1\)	str	dict, yaml, or json	Depends on --show-config		No
	--help	-h	Display a help message and exit.	\(0\)					No
top_genes	--top-genes	-n	Number of top genes by k-mer coverate to select.	\(1\)	int				Yes
transcript_id_regex	--transcript-id-regex	-p	Python regex to use for parsing transcript IDs.	\(1\)	re.Pattern		^.*cov_([0-9]+(?:\.[0-9]+))_g([0-9]+)_i([0-9]+)		Yes
	--transcripts	-i	FASTA file from which to select top genes by k-mer coverage.	\(1\)	pathlib.Path				No
verbose	--verbose	-v	Print more output than usual.	\(0\)	bool		False	True	No

Input format

The input to the script is an individual transcriptome in FASTA format, but the transcriptome is provided to this script differently than it is to other programs RNA-clique. Unlike other scripts accepting transcriptomes, select_top_genes expects a path to FASTA file itself be provided rather than a directory containing the transcripts FASTA file. Alternatively, the transcriptome can be provided via standard input.

Output format

The output of the script is a top genes file, written to standard output.

Examples

Select the top \(1000\) genes by \(k\)-mer coverage in the file transcripts.fasta, using the default regex for parsing FASTA headers. Write the results to standard output.

python -m rna_clique.select_top_genes transcripts.fasta -n 1000

Select the top \(20000\) genes by \(k\)-mer coverage from genes.fasta.gz. Use the regular expression foo([^_]*)_bar([^_]*)_baz([^_]*) to parse the transcript IDs in genes.fasta.gz.

zcat genes.fasta.gz | python -m rna_clique.select_top_genes -n 20000 \
                                -p 'foo([^_]*)_bar([^_]*)_baz([^_]*)'

select_top_genes_all

Select \(n\) top genes by \(k\)-mer coverage for each of multiple samples, in parallel. See the section on select_top_genes for an explanation of how selection is performed.

Positional arguments

Position	Config option	Description	Argument count	Type
0	input_dirs	Directories containing the transcript FASTA files.	\(\ge 0\)	list[pathlib.Path]

Options

Config option	Long name	Short name	Description	Argument count	Type	Choices	Default value	Default value (flag only)	Required
	--input-config	-c	File from which to load configuration settings.	\(1\)	pathlib.Path		OUTPUT_DIR/config.yaml		No
	--show-config		Display the computed configuration or arguments.	\(\ge 0\)	list[str]	original_args, args, or config		['config']	No
	--show-config-format		Format for displaying computed config or arguments.	\(1\)	str	dict, yaml, or json	Depends on --show-config		No
	--help	-h	Display a help message and exit.	\(0\)					No
top_genes	--top-genes	-n	Number of top genes by k-mer coverate to select.	\(1\)	int				Yes
transcripts_name	--transcripts-name	-t	Name of transcripts files in input directories.	\(1\)	str		transcripts.fasta		Yes
top_genes_dir	--top-genes-dir	-O1	Directory containing top n genes by coverage.	\(1\)	pathlib.Path		OUTPUT_DIR/od1		Yes
transcript_id_regex	--transcript-id-regex	-p	Python regex to use for parsing transcript IDs.	\(1\)	re.Pattern		^.*cov_([0-9]+(?:\.[0-9]+))_g([0-9]+)_i([0-9]+)		Yes
jobs	--jobs	-j	Number of parallel jobs to use.	\(1\)	int		THREADS - 1		Yes
output_dir	--output-dir	-O	RNA-clique analysis output root directory.	\(1\)	pathlib.Path				No
title	--title	-T	Name to assign to the analysis.	\(1\)	str		OUTPUT_DIR.name		No
	--output-config	-c2	File in which to store computed config after analysis.	\(1\)	pathlib.Path		OUTPUT_DIR/config.yaml		No
verbose	--verbose	-v	Print more output than usual.	\(0\)	bool		False	True	No

Input format

The inputs to the script are transcriptomes.

Output format

The outputs of the script are the top genes files.

Examples

Select top \(50000\) genes for the transcriptomes located at input1, input2, and input3. Write the output to rna_clique_out/od1.

python -m rna_clique.select_top_genes_all input1 input2 input3 \
                                          -O rna_clique_out -n 50000

Select the top \(1000\) genes for the transcriptomes located at input1, input2, input3, and input4. Assume that the transcript FASTA files are all named genes.fasta. Use the regular expression foo([^_]*)_bar([^_]*)_baz([^_]*) to parse the transcript IDs in each file. Write the output under top_genes.

python -m rna_clique.select_top_genes_all input1 input2 input3 input4 \
          -p 'foo([^_]*)_bar([^_]*)_baz([^_]*)' \
          -O1 top_genes

unfiltered_distance

Compute pairwise distasnces from gene matches tables alone. This script behaves similarly to filtered_distance but does not use a gene matches graph to filter the gene matches tables to include only genes having orthologs in all samples.

Although in principle filtering is preferred because it gives a fairer comparison, a distance based on the unfiltered gene matches tables might be useful when ideal components are scarce. (In turn, ideal components might be scarce for various reasons, such as having few input transcripts, or having some pairs of samples that are distantly related.)

Options

Config option	Long name	Short name	Description	Argument count	Type	Choices	Default value	Default value (flag only)	Required
	--input-config	-c	File from which to load configuration settings.	\(1\)	pathlib.Path		OUTPUT_DIR/config.yaml		No
	--show-config		Display the computed configuration or arguments.	\(\ge 0\)	list[str]	original_args, args, or config		['config']	No
	--show-config-format		Format for displaying computed config or arguments.	\(1\)	str	dict, yaml, or json	Depends on --show-config		No
	--help	-h	Display a help message and exit.	\(0\)					No
tables_dir	--tables-dir	-O2	Directory containing gene matches tables.	\(1\)	pathlib.Path		OUTPUT_DIR/od2		Yes
matrix	--matrix	-m	Output distance matrix location.	\(1\)	pathlib.Path		OUTPUT_DIR/distance_matrix.h5		Yes
output_dir	--output-dir	-O	RNA-clique analysis output root directory.	\(1\)	pathlib.Path				No
	--output-config	-c2	File in which to store computed config after analysis.	\(1\)	pathlib.Path		OUTPUT_DIR/config.yaml		No
verbose	--verbose	-v	Print more output than usual.	\(0\)	bool		False	True	No

Input format

The inputs to this script are the gene matches tables.

Output format

The output of this script is the distance matrix.

Examples

Compute an unfiltered distance matrix using gene matches tables at rna_clique_out/od2. Write the output matrix to rna_clique_out/distance_matrix.h5.

python -m rna_clique.unfiltered_distance -O rna_clique_out

Compute an unfiltered distance matrix using gene matches tables at tables_dir. Write the output matrix to matrix.h5.

python -m rna_clique.unfiltered_distance -O2 tables_dir -m matrix.h5